1. Introduction

Liver is the second largest organ in the body, and it participates in many physiological processes including lipid metabolism, bile production and excretion, detoxification, immune responses, and coagulation[1]. The increasing incidence of acute liver injury causes serious threatening to individual health and life, especially in frigid regions. Individuals living in cold zones may be at higher risk of alcohol problem, making them prone to acute liver injury and lipid metabolism disorders[2-4]. Liver injury can be caused by multifarious etiologies such as viral infections, autoimmune disorders, excessive alcohol consumption, trauma, ischemia, drug, and chemicals[5]. The production of reactive oxygen species (ROS), lipid peroxidation, hepatic cell necrosis, hepatic cell apoptosis, and proinflammatory cytokines is critical to the development of hepatocyte damage induced by various pathological stimuli[6-7].

Apoptosis-stimulating of p53 protein 1 (ASPP1) is a member of the apoptosis-stimulating of p53 protein family, which was initially identified as a transcriptional regulator of tumor suppressor p53[8]. Together with ASPP2, ASPP1 interacts with p53 to increase the reciprocal action of the latter on the promoter activity of its apoptotic target molecule Bax thereby inducing p53-induced apoptosis[9]. In nucleus, ASPP1 interacts with p53 and modulates the transcriptional activity of p53 to upregulate the expression of apoptotic target genes to induce apoptosis[10]. ASPP1 is involved in the pathogenesis of different diseases. For example, it regulates the pathogenesis and progression of acute lymphoblastic leukemia, and its methylation helps acute lymphoblastic leukemia cell (ALL) to escape apoptosis[11]. It was reported that ASSPP2 knockout protected liver from inflammation and apoptosis induced by CCl4 via activating autophagy[12]. Whether ASPP1 plays an analogous role of ASPP2 in acute liver injury remains to be explored.

Nuclear factor-κB (NF-κB) is a very important molecule which plays an essential role in regulating the expression of various genes crucial to immune, inflammatory and growth responses[13]. The NF-κB signaling pathway is closely related to inflammation of liver. Cell surface receptors, such as toll-like receptors (TLRs), are stimulated by cytokines and pathogen-associated molecular patterns (PAMPs) to initiate the signaling cascade leading to activation of NF-κB. NF-κB mediates cell proliferation and releases antimicrobial molecules and cytokines to activate immune response by regulating the expression of its target genes[14]. Inactivation of the NF-κB pathway improves oxidative stress induced by alcohol and alleviates liver injury[15]. Zhang et al found that inactivation of the toll like receptors 4 (TLR4)/NF-κB pathway via propofol protected liver from d-Galn/LPS-induced liver injury by inhibiting inflammation, oxidative stress, and hepatic apoptosis[16]. Moreover, suppression of mTOR facilitated the nuclear translocation of NF-κB p65, whereas activation of mTOR in hepatocytes decreased hepatic apoptosis, inflammation, and lipid accumulation via the NF-KB signaling pathway[17]. These studies indicate that NF-κB activation is related to liver inflammation, oxidative stress, and hepatic apoptosis in liver injury. Given the role of the NF-κB pathway in liver injury, we proposed that ASPP1 might be in involved in liver injury through the NF-κB pathway.

To our knowledge, studies on the pathophysiological role of ASPP1 in liver diseases is still scanty and its involvement in liver injury has not been studied. Therefore, the present study was directed to investigate the effects of ASPP1 deficiency on CCl4-induced liver injury and the underlying mechanism. Hepatic histology, apoptosis, inflammation, oxidative stress, and NF-κB activity in WT and ASPP1-/- mice with ALI were examined. Our results indicate that deletion of ASPP1 produced anti-inflammatory and anti-apoptotic effects in the liver with ALI, likely via acting on the NF-κB signaling pathway.

2. Results

2.1 Expression of ASPP1 and ALT/AST in Wild Type Mice Treated with CCl4

To determine whether ASPP1 is involved in liver injury, we first detected its expression alterations in WT mice treated with CCl4 to induce hepatic injury[12]. To this end, the animals were administered with 5% CCl4 (1:19 v/v in olive oil) at a dose of 2µL/g body weight by intraperitoneal injection and sacrificed after 24 hrs. The results from Western blot analysis and quantitative RT-PCR demonstrated that the expression of ASPP1 at both protein and mRNA levels was significantly increased by CCl4 (Fig. 1A-C). The serum levels of alanine transaminase (ALT) and aspartate transaminase (AST) were also significantly elevated after CCl4 treatment in WT mice (Fig. 1D, E).

Figure  1.  Expression profiles of ASPP1 and liver injury markers in wild type mice with CCl4-induced acute hepatic injury.

A, B. Protein expression of ASPP1 in liver tissue of mice 24 hrs after treatment with 5% CCl4 (intraperitoneal injection; dose: 2µL/g body weight) injection. n = 3; *P < 0. 05. C. mRNA expression of ASPP1 in liver tissue of mice 24 hrs after treatment with 5% CCl4 (ip; 2µL/g body weight). n = 3; *P < 0. 05. D, E. Serum ALT/AST activity in liver tissue of mice 24 hrs after treatment with 5% CCl4 (ip; 2µL/g body weight). n = 3; *P < 0. 05. CTL, Control; Hrs, hours; IU, international units; L, litter.

DownLoad: Full-Size Img PowerPoint

2.2 Ablation of ASPP1 Alleviates CCl4-induced Acute Liver Injury

To dissect whether the observed alterations of ASPP1 expression and ALT/AST levels induced by CCl4 are merely parallel changes or have cause-effect relationship related to acute liver injury, we repeated the same experiments in ASPP1-/- mice. Fig. 2A-C confirmed that the expression of ASPP1 was nearly null at both protein and mRNA levels in ASPP1-/- mice compared to WT counterparts (Fig. 2A-C). The liver in WT ALI mice showed aberrant appearance with whitish brown or pale color that deviate from normal healthy brown color of liver compared to WT mice because of CCl4 resulting in necrosis and ischemia of liver. In ASPP1-/- ALI mice, the color was more bright brown and closer to appearance of WT mice than in WT ALI mice, which suggested less degree of liver injuryFig. 2D).

Figure  2.  Ablation of ASPP1 alleviates CCl4-induced acute liver injury in wild-type and ASPP knockout mice.

A, B. Protein expression of ASPP1 in WT and ASPP1 knockout (ASPP1-/-) mice. n = 4; *P < 0.05. C. mRNA expression of ASPP1 in WT and ASPP1-/- mice. n =7; *P < 0. 05. D. Comparison of morphological alterations of the livers between WT and ASPP1-/- mice without or with CCl4 treatment 24 hrs post-injection. E, F. Representative images (E) and statistical data on blood flow rate (volume/minute) in the liver. n = 3; *P < 0. 05. Upper panels of E show blood perfusion to liver tissue with red, yellow and blue colors indicating high, moderate and low blood flow rates, respectively. Middle and bottom panels of E display the red-line outlined areas indicating the selected regions for the measurements of blood flow. G. Representative images of Hematoxylin and Eosin (H&E) staining (scale bar = 100µm) showing the histological alterations of liver tissue with comparisons between WT and ASPP1-/-mice with and without CCl4 treatment. The outlined area indicates necrosis tissue, and the arrows indicate balloon-like degeneration caused by CCl4. H. Statistical analysis of zone of hepatocellular necrosis grading[39]. n = 9; *P < 0. 05. CTL, control; WT, wild type; KO, knockout; ns, no significance.

DownLoad: Full-Size Img PowerPoint

We then measured the blood flow in the liver of mice and performed Hematoxylin and Eosin (H&E) staining of liver tissue. We observed found that while the blood flow was slightly higher in ASPP1-/- mice than in WT control animals, such a difference reached a statistically significant level after 24 hrs treatment with CCl4 to create ALI (Fig. 2E, F). Severe necrosis as an indication of ALI was uncovered by the derangement and deformation of hepatocytes and inflammatory cell infiltration in the surrounding areas of the central vein of the live in WT ALI mice, and these detrimental alterations were apparently ameliorated in ASPP1-/-ALI mice (Fig. 2G, H). These data indicate that ablation of ASPP1 protected against CCl4-induced acute liver injury in mice.

To assess the degree of liver injury after CCl4 treatment, we measured the levels of liver injury indicator enzymes ALT and AST. As anticipated, ALI resulted in marked elevation of ALT and AST levels in WT mice, which were significantly mitigated in ASPP1-/-ALI mice (Fig. 3A, B). Enhanced oxidative stress due to diminished endogenous antioxidants is known to exacerbate liver injury[6]. This was indeed supported by our data showing that the activity of an antioxidant enzyme superoxide dismutase (SOD) in serum was substantially decreased in WT ALI mice compared to normal WT mice (Fig. 3C). This CCl4-induced deterioration was abrogated in ASPP1-/- ALI mice, indicating the protective role of ablation of ASPP1 against ALI.

Figure  3.  Ablation of ASPP1 reduces the levels of liver injury markers and increases the levels of antioxidants.

A, B. Serum levels of ALT and AST with comparisons between WT and ASPP1-/-mice with and without CCl4 treatment. ALT, n = 8; AST, n =7, *P < 0. 05. C. Serum level of SOD with and without CCl4 treatment. n = 5; *P < 0. 05. ALT, alanine transaminase; AST, aspartate aminotransferase; SOD, superoxide dismutase.

DownLoad: Full-Size Img PowerPoint

2.3 Ablation of ASPP1 Reduces Apoptosis in Mice with Acute Liver Injury

One of the endpoints of ALI is apoptotic hepatocyte death. To clarify whether the protective role of ASPP1 deletion can be ascribed to an antiapoptotic action, we went on to detect apoptosis using TUNEL staining. As depicted in Fig. 4A & B, the number of TUNEL-positive cells were nearly 10-fold greater in the liver of WT ALI mice than in healthy WT mice, and this apoptotic change was essentially abolished in ASPP1-/- ALI mice.

Figure  4.  Ablation of ASPP1 reduces apoptosis in mice with acute liver injury.

A. Representative images of TUNEL staining with comparisons between WT and ASPP1-/-mice with and without CCl4 treatment. scale bar = 20µm. Arrows point to the TUNEL-positive cells. B. Statistical data on TUNEL-positive cells. n = 3; *P < 0.05.
C, D. Protein expression of cleaved caspase 3 with comparisons between WT and ASPP1-/-mice with and without CCl4 treatment. n = 4; *P < 0.05. E, F. Protein expression of Bax before and after CCl4 treatment. n = 4; *P < 0.05. G. The mRNA of expression of Bax with comparisons between WT and ASPP1-/-mice with and without CCl4 treatment. n = 4; *P < 0.05. H, I. Protein expression of BCL-2 with comparisons between WT and ASPP1-/- mice with and without CCl4 treatment. n = 4; *P < 0.05. J. The mRNA expression of BCL-2 with comparisons between WT and ASPP1-/- mice with and without CCl4 treatment. n = 3; *P < 0.05. DAPI, 4', 6-diamidino-2-phenylindole; TUNEL, terminal deoxynucleotidyl transferase mediate dUTP nick end labeling; β-actin, beta actin; Bax, BCL-2-associated X protein; BCL-2, B-cell lymphoma 2.

DownLoad: Full-Size Img PowerPoint

To verify the inhibitory effect of ASPP1 ablation on apoptosis, we also determined the protein levels of cleaved or activated caspase 3 and pro-apoptotic protein Bax. As expected, the level of cleaved caspase 3 was significantly increased in WT ALI mice compared to WT mice, in which was dampened by ASPP1 ablation in ALI mice (Fig. 4C, D). Similarly, the expression of Bax was also markedly reduced at both protein and mRNA levels in ASPP1-/-ALI mice relative to that in WT ALI mice (Fig. 4E-G).

Additionally, both protein and mRNA expression of anti-apoptotic protein BCL-2 was slightly decreased in WT ALI mice compared to WT mice and upregulated in ASPP1-/- ALI mice relative to WT ALI control and normal control mice (Fig. 4H-J). These results confirm that apoptosis is one of the destructive events in ALI and ablation of ASPP1 rescues this deadly incidence.

2.4 Ablation of ASPP1 Lessens Inflammation in Mice with Acute Liver Injury

To investigate the role of inflammation in ALI induced by CCl4 and the effects of ASPP1 deletion on inflammation, we measured the changes of mRNA levels of proinflammatory cytokines IL-1β, IL-6, and TNF-α, and other related genes TLR4 (an activator of the innate immune system to induce NF-κB signaling and inflammatory cytokine production), intercellular adhesion molecule 1 (ICAM1, a master regulator of cellular responses in inflammation)[18, 19]. As illustrated in Fig. 5, IL-1β, IL-6, TNF-α, TLR4, and ICAM1 were all robustly upregulated in WT ALI mice compared to healthy WT mice, and these changes were essentially revoked in ASPP1-/-ALI mice. These results suggest that ablation of ASPP1 elicits anti-inflammatory effects to relieve acute liver injury.

Figure  5.  Ablation of ASPP1 lessens inflammation in mice with acute liver injury.

A. mRNA expression of IL-1β with comparisons between WT and ASPP1-/-mice with and without CCl4 treatment. n = 3; *P < 0.05. B. mRNA expression of IL-6 with comparisons between WT and ASPP1-/-mice with and without CCl4 treatment. n = 3; *P < 0.05. C. mRNA expression of TLR4 with comparisons between WT and ASPP1-/-mice with and without CCl4 treatment. n = 5; *P < 0.05. D. mRNA expression of TNF-α with comparisons between WT and ASPP1-/- mice with and withoutCCl4 treatment. n = 4; *P < 0.05. E. mRNA expression of ICAM1 with comparisons between WT and ASPP1-/- mice with and without CCl4 treatment. n = 3; *P < 0.05. IL-1β, interleukin 1 beta; IL-6, interleukin 6; TLR4, Toll like receptors 4; TNF-α, tumor necrosis factor alpha; ICAM1, intercellular adhesion molecule 1.

DownLoad: Full-Size Img PowerPoint

2.5 Effect of ASPP1 Ablation on the Involvement of IκBα/NF-κB in Mice with Acute Liver Injury

To delineate the signaling mechanisms underlying the anti-inflammatory of ASPP1 knockout, we focused on the alterations of IκBα/NF-κB signaling using western blot analysis. We found that while the total protein levels of IκBα and NF-κB/P65 remained unaltered by CCl4 in WT mice nor in normal non-CCl4-treated ASPP1-/- mice, they were considerably increased by CCl4 in knockout mice (Fig. 6A, B and D, E). In contrast, the phosphorylated forms of the proteins p-IκBα and p-NF-κB/P65 were significantly increased by CCl4 in WT mice, but the CCl4-induced changes were mitigated by ASPP1 deletion (Fig. 6A, B and C, F). These findings indicate that ablation of ASPP1 decreases ALI-induced activation of the IκBα—NF-κB/P65 signaling to ameliorate the inflammatory responses ALI.

Figure  6.  Effect of IκBα/NF–κB in mice with acute liver injury.

A, B, C. Protein levels of IκBα and p-IκBα and their respective statistical data with comparisons between WT and ASPP1-/-mice with and without CCl4 treatment. n = 4; *P < 0.05. D, E, F. Protein levels of NF-κB/P65, p-NF-κB/P65 and their statistical analysis with comparisons between WT and ASPP1-/-mice with and without CCl4 treatment. n = 4; *P < 0.05. IκBα, inhibitor of kappa B alpha (inhibitor protein of NF-κB); p-IκBα, phosphorylated inhibitor of kappa B alpha; NF-κB/P65, nuclear factor kappa B/P65; p-NF-κB/P65, phosphorylated nuclear factor kappa B/P65; β-actin, beta actin.

DownLoad: Full-Size Img PowerPoint

3. Discussion

CCl4-induced hepatotoxicity can create liver tissue lesion or liver injury[20]. Up on exposure to CCl4, liver tissue generates ROS, lipid peroxidation, hepatic cell necrosis, hepatic cell apoptosis, ultimately resulting in hepatocyte damage[21, 22]. In addition, CCl4 also causes inflammatory response, which can mutually interacts with ROS creating a positive feedback loop to aggravate hepatic injury[23]. We report here the protective effects of ASPP1 ablation on ROS, inflammation, and apoptosis through suppressing the NF-κB signaling pathway in the liver with acute injury.

If acute liver injury is not treated promptly and effectively, it will progress to liver fibrosis and cirrhosis. Fibrosis can destruct normal liver architecture and function in the liver and is a crucial step towards cirrhosis[24-25]. A close correlation between liver function and hepatic blood flow has been reported in the literature[26-27]. In addition, liver fibrosis FII or higher was positively linked to the hepatic blood flow in chronic liver disease [26]. In non-alcoholic fatty liver disease, relative hypoxia can likely be induced by impaired blood flow to the liver, which is an important pathophysiological mechanism for the progression of the disease[27]. In the present study, we found that deletion of ASPP1 improved blood flow to the liver in mice with acute liver injury, suggesting that ASPP1 could impede the progression of acute liver injury to liver fibrosis and cirrhosis.

ASPP1, a member of pro-apoptotic p53 protein family, interacts with p53 to enhance apoptosis by causing cell cycle arrest[9]. DNA methylation of the promoter regions of ASSP1 and ASPP2 genes represses their transcription in hepatitis B virus-positive hepatocellular carcinoma (HCC) cells and promotes the growth of HCC and decreases the sensitivity of HCC cells to apoptotic stimuli[28]. Upregulation of p53 and ASPP1 expression increases apoptosis of human hepatocellular carcinoma HepG2 cells[29]. Our data show that ASPP1 deletion rescues hepatocytes from both necrosis and apoptosis in ALI mice, as reflected by the increased level of Bcl-2 and decreased levels of Bax, cleaved caspase 3 activity, and TUNEL positive cells. These results are in line with that reported in a published study on ASPP2[12]. Interestingly, cyto-protective autophagy inhibition by ASSP1 has been recently demonstrated: ASSP1 prevents autophagy related 5-12 (Atg5-Atg12) protein binding to Atg16 by directly interacting with Atg5-Atg12 to block the formation of a complex leading to autophagy[30]. It has been reported that deletion of ASPP2 protects mice from acute hepatic injury through enhancing autophagy[12].

Nuclear factor-κB (NF-κB) is an important nuclear transcription factor and is found in almost all mammalian cells, which is involved in inflammatory and immune responses and regulation of apoptosis and cellular stress[31]. Chen et al. found that NF-κB activity was related to hepatocytes apoptosis[32]. The NF-κB signaling pathway is also critical for survival of liver cancer cells [33]. Many studies have recently reported the association between NF-κB and ALI[34-35]. Inactivation of the NF-κB signaling pathway protects liver damage by inflammation and oxidative stress in LPS/D-GalN-induced ALI mice[34]. Rg1 inhibits NF-κB activity and enhances SOD activity to promote cell survival and reduce the levels of TNF-α and IL-6 in CCl-4-induced ALI mice[35]. Therefore, the NF-κB signaling pathway may be mediate pro-apoptotic signaling and inhibition of this pathway may be a signaling mechanism for the protective effect of ASPP ablation in mice with acute liver injury. It has been reported that ANK-SH3 domain of ASPP1 mediates the interactions of ASPP1 with pro-apoptosis factor NF-κB to promote apoptosis[28, 36]. In our study, the levels of phosphorylated proteins of IκBα and p65 were reduced in ALI with ASPP1 deficiency. Our results suggest that hepatoprotective effect of ASPP1 deletion might be arbitrated to suppression of the NF-κB signaling pathway leading to depression of inflammation and apoptosis and promotion of SOD activity.

In conclusion, we explored here the role of ASPP1 as a molecular target for the treatment of acute liver injury. Our findings provide the evidence for ASPP1 as a critical regulator of oxidative stress, inflammation, and apoptosis induced by CCl4 and NF-κB signaling as a mechanism for the pathophysiological role in acute liver injury. Therefore, specifically targeting ASPP1, namely ablating ASPP1, may be a promising therapeutic strategy for ALI. Nonetheless, more rigorous and in-depth studies both in vivo and in vitro are absolutely required to verify and validate this notion.

4. MATERIALS AND METHODS

4.1 Experimental Animals

A total of 40 C57BL/6 mice, 20 wild type (ASPP1+/+) and 20 knockouts (ASPP1-/-) of 6-8 weeks old were used for this study. ASPP1 global knockout mice (ASPP1-/-) were previously generated. The mice were acclimated for one week and randomly divided in to four groups (n=10): wild type treated with CCl4, wild type control (olive oil treated), ASPP1 knockouts treated with CCl4 and ASPP1 knockout control (olive oil treated). The mice were housed in pathogen free animal room in 12 hrs light/dark cycle and maintained with free access to food and drinking water. Animal procedure was carried out in accordance with animal care protocols of China National Institutes of Health and animal care and use rule of Harbin Medical University. The study was approved by the experimental animal ethical committee of Harbin Medical University.

4.2 Establishment of Liver Injury Model and Measurement of Liver Blood Flow

To establish liver injury model, initially 5% (1:19) concentration of CCl4 (batch number C1829050, Aladdin Biochemical Technology Co. Ltd, Shanghai) in olive oil was prepared and tested for significant acute liver injury development at 24 hrs duration. CCl4 was intraperitoneally injected to mice at the dose of 2 µl/g body weight. Control group mice were injected with the same dose of olive oil. Twenty-four hrs later, the mice were anesthetized and surgical incision of abdominal cavity was performed to expose the liver and blood flow measurement was taken using full-field laser perfusion imager (moor FLPI-2, moor Instruments Ltd., UK) to detect liver injury level[26, 27]. After blood flow measurement, blood was collected from each mouse. The mice were scarified, and liver tissues were harvested. The liver tissues were partly fixed in 4% paraformaldehyde for histological study and others were preserved in -80℃ freezer.

4.3 Liver Injury Markers Assessment

The collected blood samples were allowed to clot for 2hrs at room temperature, centrifuged at 3500 rpm for 20 minutes and serum was carefully collected. Serum alanine transaminase (ALT) and serum aspartate transaminase (AST) were detected using ALT and AST detection kits (ALT batch number: C009-2-1 and AST batch number: C010-2-1, Nanjing Jiancheng Bioengineering Institute, China) according to the manufacturer instruction. The observance measurement was done using 96 well micro plate readers (Power Wave XS2, Serial number: 259206, Bio Tek Instruments, USA) at a wavelength of 510 nm.

4.4 Measurements of Superoxide Dismutase (SOD)

Superoxide Dismutase (SOD) was detected using previously prepared serum. The measurement was performed using SOD commercial diagnostic kits (batch number: A001-3-1, Nanjing Jiancheng Bioengineering Institute, China) according to the manufacturer instruction using 96 well micro plate readers (Power Wave XS2, Serial number: 259206, Bio Tek Instruments, USA) at a wavelength of 510 nm.

4.5 Histopathological Staining (Hematoxylin & Eosin)

Liver tissue sample fixed in 4% paraformaldehyde were washed over night in dehydration machine and embedded in paraffin. Paraffin embedded tissue were sectioned into 5-μm slices using microtome. The sections were dewaxed and dehydrated in series of xylene and different concentration of ethanol respectively, and stained with Hematoxylin and Eosin according to procedures discussed previously with little modification[37-38]. Stained sections were examined under a light microscope (Zeiss Microscope, serial number: 3334000411, Carl Zeiss Microscopy GmbH, Germany) and images around central vein area of each group were taken. Injury were graded based on degree of hepatocellular necrosis and inflammatory infiltration[39], with 0 to represent absent, 1 to represent mild injury, 2 to represent moderate injury, and 3 to represent severe injury.

4.6 TUNEL Assay

Apoptosis was determined by the terminal deoxynucleotidyl transferase mediate dUTP nick end labeling (TUNEL) kit according to manufacturer's direction. Briefly, the sections were dewaxed and dehydrated in series of xylene and different concentration of ethanol respectively. The sections were then washed with PBS three times for 5 minutes each and fixed with 4% paraformaldehyde (200µl per slide) for 1 hr. The sections were then washed with PBS for three times for 5 minutes each and blocked with 3% of hydrogen peroxide (200µl per slide) for 10 minutes at room temperature. The sections were then washed with PBS for three times for 5 minutes each and penetrated with 200µl per slide sodium citrate solution.

The sections were then washed with PBS three times for 5 minutes each and incubated with 20µl per slide of in situ cell death detection kit (Ref. number: 11684817910, Roche) at 37℃ for 1h in a dark humidified chamber. After 1 hour's incubation, the sections were rinsed with PBS for three times and stained with DAPI for 10 minutes at room temperature for nuclear visualization. The sections were observed under fluorescence microscope (Zeiss Microscope, Serial number: 3334000411, Carl Zeiss Microscopy GmbH, Germany) and images of each sample were taken. The apoptotic ratios were calculated as TUNEL positive cells/total cells × 100%.

4.7 Protein Extraction and Western Blot

The total protein was extracted from each liver tissue sample using radio immunoprecipitation assay (RIPA) lysis buffer with 1% protease inhibitor (PI). Liver tissues were homogenized with RIPA buffer and centrifuged at 13500 rpm at 4℃ for 15 minutes. The protein concentration assay was determined using BCA kit (Cat. No. P0009-1, Bayotime). Protein extracts (80μg) were separated by electrophoresis with 8-12% SDS-PAGE gel and transferred onto a nitrocellulose membrane moistened with buffer. The membranes were blocked with 5% skimmed milk (Defco) at room temperature for 2 hrs. The membranes were then incubated with primary antibodies against ASPP1, Bax, BCL-2, Cleaved Caspase-3, IKBα, p- IKBα, NF-KB P65, p- NF-KB P65, and β-actin for 12- 36 hrs at 4℃ (Table 1). The membranes were washed with phosphate buffered saline containing 0.05% of Tween 20 (PBST) and/or 1X Tris buffered saline (TBS) and incubated with secondary antibody (dilution, 1:10000) of rabbit and mouse origins for 1 hr at room temperature. Images of the target proteins bands were scanned using infrared image forming machine (Odyssey infrared Imaging system, Model: 9120, Serial number ODY-3149, LI-COR. INC, USA). The relative integrated density values were measured and normalized to β-actin. The antibody information was listed in Table 1.

Table  1.  Information on the antibodies used for western blot analysis

Antibody	Origin	Dilutions	Cat. Number	Molecular weight	Company
ASPP1	Rabbit	1:1000	A4355	175kDa	Sigma Aldrich
Bax	Mouse	1:1000	60267-1-1g	23 kDa	Protein Tech
Bcl-2	Rabbit	1:1000	0712019	26 kDa	Cell Signaling
Cleaved Caspase 3	Rabbit	1:1000	9664S	19 kDa	Cell Signaling
IKBα	Mouse	1:1000	4814	39 kDa	Cell Signaling
p- IKBα	Rabbit	1:1000	2859	39 kDa	Cell Signaling
NF-KB P65	Rabbit	1:1000	8242	65 kDa	Cell Signaling
p- NF-KB P65	Rabbit	1:1000	3033	65 kDa	Cell Signaling
β-actin	Mouse	1:20000	66009-1-1g	42 kDa	Protein Tech
ASPP1, Apoptosis-stimulating of p53 protein 1; Bax, BCL-2-associated X protein; BCL-2, B-cell lymphoma 2(40); IKBα, Inhibitor of kappa B alpha (inhibitor protein of NF-KB); p-IKBα, phosphorylated inhibitor of kappa B alpha; NF-KB P65, Nuclear factor kappa B P65; p-NF-KB P65, phosphorylated Nuclear factor kappa B P65(18); β-actin, beta actin.

 | Show Table

DownLoad: CSV

4.8 RNA Extraction and Quantitative Real-time Polymerase Chain Reaction Analysis (qRT-PCR)

Total RNA was extracted from liver tissues of each sample using Trizol reagent (Invitrogen, NY, USA). RNA concentration was determined by Nano drop 8000 spectrophotometers (Thermo scientific). Complementary DNA (cDNA) was synthesized from total RNA of each sample using mRNA reverse transcription kit with T100TM thermal cycler machine (Model: T100TM Thermal cycler, Serial No. 621BR06831, Bio-Rad Laboratories. Inc. Singapore). The mRNA levels were detected using SYBR Green real-time fluorescent PCR kit and real-time fluorescent quantitative PCR detection system (LightCycler®96, Serial No. 12712, Roche Diagnostic GmbH, Germany) using each gene respective primers (Table 2). β-actin was used as an internal control for gene expression. The relative gene expression levels were analyzed by using fold-change (2− ^Ct) method and normalized to internal controls. The primers used was listed in Table 2.

Table  2.  Sequences of the Primer Pairs used for qRT-PCR

Gene	Sense (5'-3')	Antisense (5'-3')
ASPP1	ATGATATTAACCGTGTTCTTG	CACTTCCTCTCCACACTTCAGC
Bax	TGGAAGAAGATGGGCTGAGG	TTCCCACCCCTCCCAATAAT
Bcl-2	AACGATTGTGGCAGTCCCTT	GAAGTGCTCAGGTGCCATCT
β-actin	GACAGCAGTTGGTTGGAGCA	TTGGGAGGGTGAGGGACTTC
TNF-α	CTGAACTTCGGGGTGATCGG	GGCTTGTCACTCGAATTTTGAGA
IL-6	CTGCAAGAGACTTCCATCCAG	AGTGGTATAGACAGGTCTGTTGG
IL-1β	GAAATGCCACCTTTTGACAGTG	TGGATGCTCTCATCAGGACAG
ICAM-1	TGCCTCTGAAGCTCGGATATAC	TCTGTCGAACTCCTCAGTCAC
TLR4	ATGGCATGGCTTACACCACC	GAGGCCAATTTTGTCTCCACA
ASPP1, Apoptosis-stimulating of p53 protein 1; Bax, BCL-2-associated X protein; BCL-2, B-cell lymphoma 2; β-actin, Beta actin; TNF-α, Tumor necrosis factor alpha; IL-6, Interleukin 6; IL-1β, Interleukin 1beta; ICAM1, Intercellular adhesion Molecule; TLR4, Toll like receptors 4.

 | Show Table

DownLoad: CSV

4.9 Statistical Analysis

Data are presented as mean ± standard deviation (SD). All variables were measured with more than three samples per group. Graph Pad prism version 6 was used to analyze the data. Students t-test was used to compare differences between groups and one-way analysis of variance (ANOVA) followed by Tukey's multiple comparison test were used to compare differences among groups. A value of P < 0.05 was considered to be statistically significant.

Supplementary Material

Supplementary material supporting the findings of this study are available from the corresponding author upon reader's reasonable request.

Acknowledgements

This work was supported by National Key R&D Program of China (2017YFC1307404 to Zhenwei Pan), National Natural Science Foundation of China (81870295 to Zhenwei Pan), Funds for Distinguished Young Scholars of Heilongjiang Province (to Zhenwei Pan), Heilongjiang Touyan Innovation Team Program and CAMS Innovation Fund for Medical Sciences (CIFMS) and Yu Weihan Excellent Youth Foundation of Harbin Medical University (001000004 to Zhenwei Pan).

Authors Contributions

Tolessa Muleta Daba: Conceptualization, Methodology, Validation, Formal analysis, Investigation, Writing - Original Draft. Xiang Huang: Visualization, Methodology, Validation, Formal analysis, Investigation. Timur Yagudin: Writing - Review & Editing. Ying Yang: Investigation, Methodology. Xiaoyu Fu: Investigation, Methodology. Yue Zhao: Investigation, Methodology. Haiyu Gao: Investigation, Methodology. Zhenwei Pan: Conceptualization, Resources, Writing - Review & Editing, Supervision, Project administration, funding acquisition.

Conflict of Interest

Zhenwei Pan is an Editorial Board Member. The article was subject to the journal's standard procedures, with peer review handled independently of this Member and his research groups. All authors declare no other conflicts of interest.